...

Regulated Breathless receptor tyrosine kinase activity required to pattern cell migration and branching in the Drosophila tracheal system. Genes and Development 10, 2912-2921. pdf

by user

on
Category: Documents
12

views

Report

Comments

Transcript

Regulated Breathless receptor tyrosine kinase activity required to pattern cell migration and branching in the Drosophila tracheal system. Genes and Development 10, 2912-2921. pdf
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated Breathless receptor tyrosine kinase activity required to
pattern cell migration and branching in the Drosophila tracheal
system.
T Lee, N Hacohen, M Krasnow, et al.
Genes Dev. 1996 10: 2912-2921
Access the most recent version at doi:10.1101/gad.10.22.2912
References
This article cites 26 articles, 8 of which can be accessed free at:
http://genesdev.cshlp.org/content/10/22/2912.refs.html
Article cited in:
http://genesdev.cshlp.org/content/10/22/2912#related-urls
Email alerting
service
Receive free email alerts when new articles cite this article - sign up in the box at
the top right corner of the article or click here
To subscribe to Genes & Development go to:
http://genesdev.cshlp.org/subscriptions
Copyright © Cold Spring Harbor Laboratory Press
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated Breathless receptor tyrosine
kinase.activity required to pattern cell
migration andbranchmg m the
Drosophila tracheal system
T z u m i n Lee, 1 Nir H a c o h e n , 2 Mark Krasnow, 2 and D e n i s e J. M o n t e l l Ls
1Department of Biological Chemistry, Johns Hopkins School of Medicine, Baltimore, Maryland 21205-2185 USA;
2Department of Biochemistry, Stanford University School of Medicine, Stanford, California 94327 USA
Receptor tyrosine kinases (RTKs) are members of a diverse class of signaling molecules well known for their
roles in cell fate specification, cell differentiation, and oncogenic transformation. Recently several RTKs have
been implicated in cell and axon motility, and RTKs are known to mediate chemotactic guidance of tissue
culture cells. We have investigated whether the Drosophila FGF receptor homolog, Breathless (BTL), whose
activity is necessary for each phase of branching morphogenesis in the embryonic tracheal system, might play
a role in guiding the directed migration of tracheal cells. We found that expression of a constitutively active
receptor during tracheal development interfered with directed tracheal cell migration and led to extra
secondary and terminal branch-forming cells. Reduction in endogenous BTL signaling enhanced the cell
migration defects while suppressing the ectopic branching defects. These results are consistent with a model
for tracheal development in which spatially regulated BTL activity guides tracheal cell migration and
quantitatively regulated BTL activity determines the patterns of secondary and terminal branching cell fates.
[Key Words: Cell migration; branching morphogenesis; receptor tyrosine kinase]
Received June 5, 1996; revised version accepted September 24, 1996.
Morphogenesis of branched tubular networks is an essential element of the normal development of several
organ systems, including the lungs and vasculature. Formation of branched tubular structures involves determination of multiple cell fates, cell migration, and extensive cell shape changes. The mechanisms by which these
diverse biological processes are coordinated to establish
a complicated network remain a puzzle.
The Drosophila tracheal (respiratory) system is a network of branched tubules that ramify extensively
through the body, allowing oxygen diffusion to all tissues. The embryonic tracheal system originates from 10
pairs of tracheal placodes, each of which invaginates to
form a sac of about 80 tracheal cells. The tracheal cells
then migrate along stereotyped pathways, and some
branches meet and fuse to form the primary pattern of
tracheal branches (Manning and Krasnow 1993; Samakovlis et al. 1996). Subsequently, selected tracheal cells
generate secondary branches. Each secondary branch is
formed by a single tracheal cell and extends in a stereotypical direction. Finally, terminal branches are formed
as subcellular tubes within long cytoplasmic processes.
Terminal branches originate from most secondary
SCorrespondingauthor.
2912
branch-forming cells and their extensions are believed to
be regulated by target tissue oxygen need. A gene regulatory hierarchy controls the different stages of branching, and a number of enhancer trap lines have been described that mark specific subsets of tracheal cells, such
as secondary or terminal branch-forming cells (Samakovlis et al. 1996). However, the spatial cues that select
these cell fates are not known.
Specific receptor tyrosine kinases (RTKs) have been
found to play a role in morphogenesis of tubular networks in a variety of organisms. In particular, fibroblast
growth factors (FGF) and their receptors are potent angiogenic factors in mammals, and Breathless (BTL), a
Drosophila FGF receptor homolog, the product of the
breathless (btl) gene, is known to be required for proper
tracheal morphogenesis (Glazer and Shilo 1991; Klambt
et al. 1992; Reichman-Fried et al. 1994). Furthermore,
RTKs are well known for their ability to control cell fate,
cell differentiation programs, and cell motility (Basler et
al. 1991; Montell 1994; Obermeier et al. 1994; Schuchardt et al. 1994b; Bladt et al. 1995; DeVore et al. 1995).
Thus RTKs are candidates for controlling many aspects
of branching morphogenesis.
The breathless gene was cloned by low-stringency hybridization with a vertebrate FGF receptor probe and was
found to be expressed specifically in tracheal cells, mid-
GENES& DEVELOPMENT10:2912-2921 9 1996 by Cold SpringHarborLaboratoryPress ISSN 0890-9369/96 $5.00
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated receptor activity in cell migration
line glial cells, and salivary duct cells of the Drosophila
embryo (Glazer and Shilo 1991). In btl mutant embryos,
tracheal cells fail to migrate out from the tracheal sacs,
and hence the embryos display severe tracheal system
defects (Klambt et al. 1992). The number of tracheal cells
and the formation of tracheal sacs are not affected in btl
loss-of-function mutants, suggesting that the BTL RTK
is specifically required for subsequent morphogenetic
events. BTL activity is also required for formation of secondary and terminal branches (Reichman-Fried and Shilo
1995). However, the precise role of breathless in tracheal
morphogenesis is not clear. For example, it is not known
whether BTL activity primarily determines various cell
fates within the tracheal system, promotes general cell
motility, or plays a chemotactic guidance role in tracheal
cell migration.
It has been shown previously that constitutively active Sevenless (SEV) functions effectively in cell fate determination (Dickson et al. 1996). However, a chemotactic guidance role for a receptor would, by definition, require different levels of receptor activity in different
parts of each tracheal cell. We found that a constitutively
active BTL receptor inhibited primary branch outgrowth
but promoted ectopic secondary and terminal branch formation. Our results support the hypothesis that regulated BTL activity guides tracheal cell migration and determines the pattern of secondary and terminal branches
by selecting tracheal cell fates. Thus regulation of BTL
activity is key to each phase of tracheal morphogenesis.
Results
KBTL, a putative constitutively active RTK
Activation of RTKs typically depends on ligand-induced
dimerization followed by autophosphorylation (Fantl et
al. 1993). Therefore replacement of the ligand-binding
extracellular domain of a receptor with a protein domain
that spontaneously dimerizes might be predicted to create a constitutively active receptor. This rationale was
employed previously to create a constitutively active Xenopus FGFR chimera, composed of the dimerization domain of K repressor and the transmembrane and cytoplasmic domains of Xenopus FGFR (E. Amaya, pers.
comm.). We used the same strategy to make a putative
constitutively active lambda-BTL chimera (KBTL, Fig.
1A), and transgenic fly strains carrying the Abtl transgene under the control of the hsp70 heat-inducible promoter and the GAL4-inducible UAS promoter (Brand and
Perrimon 1994)were generated.
To determine whether KBTL was constitutively autophosphorylated on tyrosine, immunoprecipitation (IP)
and immunoblotting studies were performed. After expressing kBTL in embryos by heat shock, embryo lysates
were immunoprecipitated with either anti-BTL or antiphosphotyrosine (pY) antibodies, and then the immune
complexes were analyzed by PAGE followed by Western
blotting with either anti-BTL or anti-pY antibodies. The
~BTL protein was immunoprecipitated by anti-pY Ab as
shown in Figure 1B, lane 7. In addition, the KBTL protein
immunoprecipitated with the anti-BTL Ab was recog-
Figure 1. Constitutively active and kinase-defective BTL con-
structs. (A) Schematic drawing of the ;~BTL chimera and
BTLK-~R. KBTL was constructed by replacing the extracellular
domain of BTL with the dimerization domain of Xcl repressor.
BTLK~R was constructed by mutating the conserved lysine
within the ATP binding domain to arginine. (B) Detection of
BTL protein and phosphotyrosine residues in KBTL, Torso 4~
BTL, and BTL K--*R. After heat shock-induced expression of the
BTL transgenes in embryos, lysates were immunoprecipitated
with R-BTL (lanes 1,4,6,8,i1,13), e~-pY (lanes 2,5,7,9,12,14), or
~-MYC, which detects the MYC-tagged Tor4~
protein
(lanes 3,10). The immune complexes were analyzed by SDSPAGE and Western blotting with R-BTL Ab (lanes 1-7) or ~-pY
Ab (lanes 8--14).
nized by the anti-pY Ab in a Western blot (Fig. 1B, lane
13). These results showed that ~BTL, which lacks the
ligand-binding domain, could undergo ligand-independent autophosphorylation, as expected of a constitutively active RTK. In contrast, less phosphotyrosine was
detected using the same analysis to examine
Torso4~
(Fig. 1B, lane 2), a putative constitutively
active BTL receptor, reported previously (ReichmanFried et al. 1994). These results suggested that the KBTL
chimera provided more activated BTL kinase activity
t h a n T o r s o 4~
As a negative control, we examined the phosphorylation state of a putative kinase-defective BTL RTK
(BTLK~R), which was made by mutating the conserved
lysine residue within the ATP binding domain to arginine (Fig. 1A). Transgenic fly strains carrying the btI K~R
transgene under heat shock promoter control were generated, and immunoprecipitation followed by Western
blot analysis revealed that BTL K~R protein was expressed stably following heat shock; however, as expected, no phosphotyrosine could be detected (Fig. 1B,
lane 5).
GENES & DEVELOPMENT
2913
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Lee et al.
Effects of ABTL in btl m u t a n t e m b r y o s
A constitutively activated receptor would be expected to
substitute effectively for the wild-type receptor if its role
were to affect cell fate determination or cell differentiation, as is true for the SEV RTK (Dickson et al. 1996).
Thus, although the pattern of activation of this receptor
is important because the constitutively active receptor
alters the fates of neighboring cells, the activated form
functions properly in the cells in which it is normally
active. However, if the BTL receptor served a chemotactic guidance function, one would expect the constitutively active receptor not to provide the necessary spatial
information and not to substitute effectively for the
wild-type receptor in tracheal cells (see, e.g., Kundras et
al. 1994).
To determine whether regulated BTL activity was essential for migration of tracheal cells away from the tracheal sacs, we compared the ability of ~BTL and wildtype BTL to rescue btl m u t a n t embryos. The tracheal
system was visualized by staining the tracheal l u m e n
with the monoclonal antibody (mAb)2A12. Figure 2A
shows the wild-type pattern of tracheal tubules, which
are lined by the tracheal cells. In btl nSaa3 m u t a n t embryos, tracheal cells fail to migrate, remaining in a tra-
cheal sac-like formation (Klambt et al. 1992). Despite
this, the cells still m a k e a l u m e n and express the l u m i n a l
antigen detected by mAb2A12 (Fig. 2B). After introducing the wild-type btl transgene under heat shock promoter control into the btl m u t a n t background, we found
that a single heat shock delivered at 4--5 hr of development rescued tracheal cell migration defects and restored the primary branching pattern (Fig. 2C; Table 1).
In contrast, heat shock-induced expression of either
BTL K~R or KBTL failed to rescue tracheal cell migration
defects in stage 15 btl m u t a n t embryos (Fig. 2D and E;
Table 1). When the hs-KBTL embryos were allowed to
develop to stage 16 or 17 {16 hr after egg laying), fusion of
the dorsal trunk was observed in two to three posterior
segments of approximately half of the embryos (Table 1).
Thus constitutively active BTL could rescue only a small
fraction of the tracheal pattern, and this was significantly delayed.
If regulated BTL activity were essential to the normal
pattern of tracheal cell migration, KBTL might partially
obscure the normal pattern of receptor activity, even in
the presence of the wild-type receptor, and thereby interfere with the normal migration pattern. To test this
possibility, we determined the ability of hs-btl to rescue
btl m u t a n t embryos w h e n coexpressed with KBTL. The
rescue was less complete than that provided by hs-btl
alone (Fig. 2F; Table 1). Taken together these results indicated that spatially or quantitatively regulated BTL activity was required for the normal pattern of primary
branching.
Disruption of w i l d - t y p e tracheal s y s t e m d e v e l o p m e n t
by ABTL
If BTL were normally activated in a spatially restricted
pattern, expression of a constitutively active BTL recep-
Table 1. Quantitative analysis of dorsal trunk defects
Genotype
Figure 2. Rescue of tracheal cell migration defects in btl mutant embryos by various bt/transgenes. Nomarski optics images of embryos stained for tracheal lumen antigen 2A12, to
illustrate the extent of tracheal cell migration in embryos of the
following genotypes: (A)wild type; (B) homozygous btl H82a3
mutant; (C) btlH82a3/ btlH82a3; hs-btl; (D) btlH82a3/ btlH82a3; hsbtlK~R; (E) btlH82aa/ btlH82a3; hs-hbtl; and (F) btlH82a3/ btlH82a3;
hs-Abtl; hs-Abtl. Embryos were heat shocked for 1 hr at stage 11,
incubated at 18~ and fixed at stage 15. The normal pattern of
primary branches can be seen in A and C. To determine genotypes, embryos were also stained with an anti-[3-galactosidase
antibody, followed by a fluorescently labeled secondary antibody, to detect [3-galactosidase expressed from a transgene on
the TM3 balancer chromosome. Bars, 25 ~m.
2914
GENES & D E V E L O P M E N T
+ / + (stage 14/15)
b tl/+
btl/btl
btl/btl;hs-btl (stage 14/15)
btl/btl;hs-Abtl (stage 14/15)
btl/btl;hs-hbtl (stage 16/17)
btl/btl;hs-btl;hs-~btl
Istage 14/15)
+/+ ;hs-hbtl (stage 14/15)
btl/+ ;hs-hbtl {stage 14/15)
+ / + ;hs-hbtl;hs-btl K-~R
(stage 14/15)
+/+ ;hs-btl K--'R (stage 14/15)
Average no.
of dorsal
trunk
interruptions
per embryoa
0
0
9
0
9
7
Embryos with
dorsal trunk
interruptions
(%)
0
0
100
0
100
100
5
2.5
4
90
50
70
8
3
90
60
aThe average number of dorsal trunk interruptions per embryo
includes those embryos with no interruptions.
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated receptor activity in cell migration
tor might partially obscure the normal pattern of BTL
activity and cause a dominant phenotype. To test this
hypothesis, we examined the effects of inducing XBTL in
wild-type embryos. In stage 14 embryos, the dorsal trunk
branches have fused normally (Fig. 3A); in stage 16 embryos, the basic embryonic tracheal system with the
characteristic pattern of secondary branches is established (Fig. 3B). However, following expression of kBTL
at stage 11, development of primary branches was disrupted; the dorsal t r u n k was incompletely fused in most
stage 14 embryos (Fig. 3C; Table 1) and abnormal primary branches and ectopic secondary branches were observed in most stage 16 embryos (Figs. 3D and 4).
To describe the effects of expressing ~BTL on wildtype tracheal system development in more detail, several
representative abnormalities are shown in Figure 4.
C o m m o n abnormalities included the following: formation of three major cerebropharyngeal branches, instead
of two (Fig. 4, cf. A and B); misguidance of cerebropharyngeal branches (Fig. 4B); extra branching of dorsal
branches (Fig. 4, cf. C and D); absence of dorsal branches
(Fig. 4D); misguidance and extra branching of ganglionic
branches (Fig. 4, cf. E and F); absence of ganglionic
branches (Fig. 4, cf. G and H); and failure of the lateral
t r u n k branches from adjacent segments to fuse (Fig. 4H).
Figure 4.
Enhancement of ABTL-induced tracheal cell migration
defects by reduction in wild-type BTL
The adverse effects of ~BTL on tracheal patterning could
be attributable either to a lack of spatial regulation of the
activity or to increased levels of BTL activity. If the de-
Figure 3. Effects of KBTL on the developing tracheal system in
stage 14 and 16 embryos. Nomarski optics images of embryos
stained for tracheal lumen antigen 2A12. Wild-type (A,B) and
hs-~btl embryos in which expression of hs-,~btl had been induced at stage 11 (C,D) are shown. (A,C) Stage 14 embryos; (B,D)
stage 16 embryos. Normal (A) and unfused (C)dorsal trunks are
indicated by the white arrowheads. A normal (B) and an abnormal (D} visceral branch are indicated by the white arrowheads.
Other normal primary branches (B) and their abnormal counterparts in hs-Abtl embryos (D) are indicated by the black arrowheads. (B) The following primary branches are indicated: (DB)
dorsal branch; (DT) dorsal trunk, (VB) visceral branch; (LT) lateral trunk; (GB) ganglion branch. Asterisks indicate normal secondary branches. Bars, 25 ~m.
Representative abnormalities in the developing tracheal systems of hs-,~btl embryos. Nomarski optics images of
embryos stained for tracheal lumen antigen 2A12. Wild-type
(A,C,E,G) embryos and embryos in which expression of Abtl was
induced at stage 11 (B,D,F,H) are shown. Embryos were fixed at
stage 15. {A,B) Arrowheads indicate the normal two cerebropharyngeal branches in (A) and the three found in (B). (C,D) The
arrowheads indicate normal (C) and abnormal or missing (D)
dorsal branches. (E) Normal ganglionic branches are indicated.
(F) The arrowhead indicates an ectopic branch emanating from
one of the ganglionic branches. (G,H) Fused lateral trunks (arrowheads) can be seen in G whereas the lateral trunks are unfused in H. Schematic representations of the stained tracheal
branches are shown next to each micrograph. (A,B) The tracheal
branches in the schematics are labeled with letters to facilitate
identification of corresponding branches. (B) The asterisk indicates the extra cerebropharyngeal branch.
fects observed in Abtl embryos were attributable to a
lack of spatial regulation of BTL, one might predict that
the defects would be exacerbated if endogenous, patterned BTL activity were reduced, for example, in flies
heterozygous for loss-of-function m u t a t i o n s in the btl
locus. On the other hand, if the kBTL-induced defects
were attributable to the high level of BTL activity, one
might expect reducing the a m o u n t of endogenous receptor to reduce overall receptor activity levels and, therefore, to ameliorate the defects. If the levels of kBTL activity were so high as to overwhelm the endogenous activity completely, then one would expect reducing
expression of the wild-type receptor to have no effect on
the ~BTL-induced defects.
To distinguish between a requirement for spatial regulation of BTL activity and a requirement for quantitative regulation, we compared tracheal development in
GENES & DEVELOPMENT
2915
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Lee et al.
embryos that were wild-type for the endogenous btl locus with that of embryos that were heterozygous for
btl HSea3, a strong loss-of-function allele. After crossing
hs-~btl into the heterozygous btl HSea3 background, heat
shock treatments were carried out. Stage-specific enhancement of hBTL-induced phenotypes was observed.
For example, the dorsal trunk defects of stage 14 embryos were exaggerated in heterozygous btl H82a3 embryos (Fig. 5). Whereas induction of hBTL in otherwise
wild-type embryos typically resulted in two to three interruptions in the dorsal trunk (Fig. 5A) and never more
than four, induction of hBTL in embryos heterozygous
for btl HSea3 resulted in unfused dorsal trunks with four
or more interruptions in about 40% of stage 14 embryos
(Fig. 5B; Table 1).
To investigate further the interactions between endogenous BTL activity and hBTL, we examined the effects of
coexpression of BTL K-~R and hBTL. Expression of the
kinase defective BTL K--*R alone caused dominant-negative effects on tracheal development {Fig. 6, cf. A and B;
see also Fig. 8B), presumably attributable to (1) binding of
ligand to inactive BTL K--*Rdimers, reducing the effective
ligand concentration, and (2) heterodimerization of inactive BTL K--*R monomers with wild-type BTL protein.
When the transgene was induced at stage 11, defects in
primary branching were observed, such as interruptions
in the dorsal trunks and absence of some primary
branches (Fig. 6B).
To address the effects of reducing endogenous BTL activity on the hBTL-induced phenotypes, we coexpressed
BTL K--'R and Xbtl at stage 11. The effects of BTL K--*Rand
kBTL on primary branching appeared to be synergistic
(Table 1). That is, primary branching was almost completely blocked in about 60% of embryos (Fig. 6D). Because formation of primary branches depends mainly on
guided tracheal cell migrations, this observation indicated that the pattern of BTL activity was more important than the level of BTL activity during the period of
cell migration.
Effects of unregulated BTL activity on secondary and
terminal tracheal branching
6. Effects of coexpressing btl K~R and Abtl at stage 11.
Nomarski optics images of embryos stained for tracheal lumen
antigen 2A12. Expression of indicated transgenes induced at
stage 11. Embryos were fixed at stage 15. Compared with the
wild-type tracheal system (A), unfused dorsal trunks {B,C,D,
white arrowheads) and abnormal visceral branches (B,C,D,
black arrowheads) were obvious, among other abnormalities.
Figure
pression of secondary and terminal branch markers during tracheal development (Samakovlis et al. 1996). To
confirm that the ectopic fine branches in hs-;~btl embryos arose because of a change in tracheal cell fate, we
examined the expression of secondary and terminal
branch markers in these embryos. As shown in Figure
7A, ectopic secondary branch formation was accompanied by the ectopic expression of the Pantip-1/pointed
secondary branch marker. In these experiments, heat
shocks were performed after stage 12 to reduce the probability that secondary branch abnormalities resulted as a
secondary consequence of abnormal primary branching.
The extra branching cells also expressed the terminal
branch marker Terminal-1/DSRF (Fig. 7B). The extra
branching cells presumably arose from a transformation
in cell fate because, under some regimens of expression
of KBTL, many or a l l tracheal cells in a primary branch
can be induced to express the Terminal-1 marker (Fig.
7C) even though the number of cells was unchanged.
It has been shown previously that btl is required for ex-
Rescue of BTLK--*g-induced secondary branching
defect by hBTL and suppression of kBTL-induced
ectopic secondary branching by BTL K--'g
Figure 5. Effects of reducing btl gene copy number on Abtl
phenotypes. Nomarski optics images of embryos stained for tracheal lumen antigen 2A12. Expression of Abtl was induced in
either wild type (A) or heterozygous btl H82a3(B) by delivering a
heat shock at stage 11; then embryos were incubated at 18~
and fixed at stage 14. Genotypes were determined as described
in Fig. 2. Defects in dorsal trunks are indicated.
2916
GENES & DEVELOPMENT
The observation that BTL activity is both necessary and
sufficient to induce secondary or terminal branches in
tracheal cells implies that selective activation of BTL
determines the normal pattern of secondary or terminal
branches. To distinguish whether, within a given
branch-forming cell, the level of BTL activity or the pattern of BTL activity was more important in determining
secondary branches, we determined the effects of co-expressing BTL K-'R and KBTL.
In contrast to the synergistic effects on primary
branching, the effects of BTL K~R and KBTL appeared to
antagonize each other with respect to secondary branch-
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated receptor activity in cell migration
Effects of coexpressing btl K ~R and Abtl at stage 12 on
tracheal system development. Nomarski optics images of embryos stained for tracheal lumen antigen 2A12. (A) Wild-type
stage-15 tracheal system: (B-D) Expression of indicated transgenes was induced at stage 12, and embryos were fixed at stage
15. White arrowheads indicate dorsal branches, which can be
seen in every segment of the tracheal system in A and C but are
missing from the indicated segments in B and D. Black arrowheads indicate visceral branches with fewer (B) or more (C) than
the normal (A) secondary branches.
Figure 8.
Figure 7.
Expression of markers for secondary and terminal
branch-forming cells in hs-Abtl embryos. (A,B) hs-Abtl embryos
were heat shocked once at late stage 12 and once at late stage 13,
then aged and fixed and stained for 2A12 antigen and the
Pantip-1 (pointed) lacZ marker (A) or the DSRF terminal branch
marker (B). (A, left) The Pantip-1 marker can be seen in the cell
nucleus of an ectopic secondary branch (arrowhead) that has
formed in the middle of a ganglionic branch (GB). (A, right) A
wild-type embryo of the same age, for comparison, shows that
the GB is unbranched and that the marker at this stage is not
expressed in the GB except in the leading cell (not visible in this
plane of focus). (B, left) DSRF protein is seen in the normal and
two ectopic branches (arrowheads) that have formed at the end
of the dorsal branch (position indicated by the thin dashed line).
(B, right) A wild-type embryo, for comparison, shows the single
DSRF-expressing branch. The thick dashed line indicates the
position of the dorsal trunk. (C) Embryos were heat shocked late
in stage 11 and again late in stage 12 and then aged and stained
for DSRF at stage 13 or 14. Under these conditions (left), expression of DSRF is seen in most or all cells of the two GBs shown
(arrowheads point to the leading cell of each GB). In a wild-type
embryo of the same age (right), expression of DSRF is restricted
to the leading cell (arrowheads). The asterisks indicate the position of a DSRF-expressing cell in the lateral trunk posterior
branch from which the GB extends. In the hs-Abtl embryos, the
number of cells in the GB is unchanged from wild type.
ing. W h e n the h s - b t l K~R transgene alone was induced at
stage 12, most primary branches remained unaffected
but formation of secondary branches was inhibited. This
effect was especially pronounced in the visceral region
(Fig. 8B). In contrast, w h e n both transgenes were induced
at stage 12, most embryos looked more like wild-type
than heat shock-treated embryos carrying either transgene alone (Fig. 8). These observations suggest that expression of KBTL rescued formation of secondary
branches in embryos expressing BTL K--*R and expression
of h s - b t l K--'R inhibited induction of ectopic secondary
branches because of expression of Abtl. In contrast to the
deleterious effects of KBTL on primary branching, constitutive BTL activity could replace endogenous BTL activity in formation of secondary branches.
Effects of cell a u t o n o m o u s
)t-BTL expression
To determine w h e t h e r the effects described so far were
attributable primarily to cell a u t o n o m o u s effects of activated BTL, we used the GAL4/UAS system (Brand and
Perrimon 1994) to direct XBTL expression specifically in
tracheal cells. Germ-line transformants carrying a UAS)tBTL transgene were crossed to flies carrying a GAL4
enhancer trap line expressed in tracheal cells beginning
in stage 13 (A. Brand, unpubl.). Embryos from such a
cross were collected, aged, and stained for the 2A12 tracheal l u m e n antigen. Stalled or missing primary
branches as well as misguided and ectopic secondary
branches were observed in nearly every embryo (Fig. 9).
The defects occurred most frequently in the dorsal
branches and the ganglionic branches, w h i c h form later
than the dorsal trunk and lateral branches, perhaps as a
result of the relatively late i n d u c t i o n of )tBTL.
Effects of a c t i v a t e d S E V on tracheal s y s t e m
d e v e l o p m en t
To determine the specificity of the effects of XBTL, we
examined the effects of expressing an activated SEV on
tracheal system development. Compared w i t h activated
BTL, activated SEV induced at stage 11 did little h a r m to
the developing tracheal system (Fig. 10A) despite strong
deleterious effects on viability (70% of embryos arrested
development following a 40-min heat shock, compared
with 0% for )tBTL embryos). Thus tracheal cell migration appeared to be specifically sensitive to changes in
BTL activity. In contrast w i t h the subtle effect on primary branching, ectopic SEV activity induced at stage 13
was capable of inducing numerous, ectopic secondary or
GENES & DEVELOPMENT
2917
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Lee et al.
10. Effects of expressing activated SEV on tracheal system development. Nomarski optics images of embryos stained
for tracheal lumen antigen 2A12. Embryos carrying the
torso4~
transgene under heat shock promoter control were
heat shocked at either stage 11 (A) or stage 13 (B), aged, and then
fixed at stage 15. (A,B) The primary branching pattern looks
normal. (D) Close-up view of the region indicated in B, showing
multiple ectopic secondary branches emanating from visceral
(white arrowheads) and dorsal (black arrowheads) branches, although these two kinds of branches are not normally found in
the same focal plane. (C) Comparable view of visceral branches
in a wild-type embryo.
Figure
Figure 9. Effects of cell autonomous expression of ~BTL. (A)
Wild-type dorsal branches are indicated by the arrowheads. (B)
In embryos expressing ~BTL under the control of a tracheal
GAL4 line, beginning at stage 13, defective dorsal branches were
observed in nearly every embryo. Ectopic secondary branches
(white arrowhead) and stalled dorsal branches (black arrowhead)
were commonly observed. (C} In wild-type embryos, the ganglionic branch (white arrowhead, c) emanates from a lateral branch
(b). Two secondary branches normally form (black arrowheads)
at the point of fusion between lateral branches (a,b) from adjacent segments. In embryos expressing KBTLunder the control of
tracheal GAL4 (D), missing ganglionic branches were observed
(white arrowhead) and misguided secondary branches were
common (black arrowheads). Schematic representations of (C)
and (D) are shown below. The asterisks indicate secondary
branches that form normally, for a reference point.
terminal branches (Fig. 10B, and cf. D with C), which
were considerably longer than those induced by KBTL.
The differential effects of ectopic SEV activity on primary versus secondary or terminal branching further
support the idea that BTL plays distinct roles in mediating different developmental processes to establish the
complete tracheal system.
Discussion
The Drosophila tracheal system has become an informative model system for unraveling the molecular mechan i s m s underlying branching morphogenesis, a process
that requires the coordination of cell fate determination
and differentiation with directed cell migration, branch
fusion, and tube formation. Although it has been shown
previously that the BTL RTK is required for primary,
secondary, and terminal branching in the tracheal system, our studies have addressed the question of whether
spatially or quantitatively regulated BTL activity contributes to patterning tracheal cell migration and/or
branching.
2918
GENES & DEVELOPMENT
Role of BTL in tracheal cell migration
Although it has been k n o w n for some time that RTKs
can mediate chemotaxis in vitro (Kundras et al. 1994),
appreciation of the potential importance of a direct role
for RTK signaling in cell and axon m o t i l i t y in vivo during development has been relatively recent. One of the
first indications that RTKs might regulate cell migration
came with the identification of c-Kit, w h i c h encodes an
RTK, as the gene mutated in White m u t a n t mice, w h i c h
display cell migration defects (Fleischman 1993). More
recently, mutations in other RTKs have been shown to
lead to defects in neural crest cell migration (Schuchardt
et al. 1994) and myoblast migration (Bladt et al. 1995)
during mouse embryogenesis, as well as sex myoblast
migration in the nematode (DeVore et al. 1995) and axon
pathfinding in Drosophila (Callahan et al. 1995). Furthermore, RTK-mediated repulsion has been suggested to
play a role in guiding retinal axons to the appropriate
target sites in the tectum (Cheng et al. 1995; Drescher et
al. 1995). Therefore the question of whether RTK activity can guide cell and axon migrations in vivo m a y have
general implications.
The primary tracheal branches of the Drosophila embryo form w h e n individual cells, or pairs of cells, located
at six different positions w i t h i n each cluster of about 80
tracheal cells, lead the directed migration along stereotypical pathways to form the six primary branches. This
phase of tracheal development clearly requires the activity of the BTL RTK because it does not occur in btl
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated receptor activity in cell migration
mutant embryos. One possibility is that BTL, and perhaps other RTKs, guides cell migration directly via a
chemotactic mechanism. This model predicts that the
spatial pattern of BTL activity would be critical to primary tracheal branching. The inability of constitutively
active BTL to rescue btl mutant defects supports the
chemotactic guidance model.
Our results indicate that the defects caused by kBTL
were not primarily attributable to extraordinarily high
levels of receptor activity because decreasing endogenous btl expression or activity enhanced KBTL tracheal
cell migration defects. If the level of kBTL activity were
much higher than the endogenous level, we would have
expected reducing the level of endogenous activity to
have little or no effect. Moreover, if the overall level of
BTL activity were the critical factor in tracheal cell migration, reducing the endogenous activity should have
ameliorated the kBTL migration defects. Nor does temporal control of BTL activity seem to be particularly important, as we have observed rescue of btl mutant embryos following heat shock-induced expression of wildtype BTL as late as 9 hr after egg laying (stage 12 or 13; T.
Lee and D.J. Montell, unpubl.). Taken together, the results support the notion that spatial regulation of BTL
activity contributes to the guidance of tracheal cell
migration.
It is likely that the tracheal system defects we observed were attributable primarily to cell autonomous
effects because tracheal cell-specific expression of kBTL
caused qualitatively similar defects. Missing or stalled
primary branches were observed among the dorsal and
ganglionic branches, and misguided or ectopic secondary
branches were common. Similar defects were not observed in the dorsal trunk or in lateral branches in this
genotype, although they did occur in the hs-Abtl embryos. The differences were presumably attributable to
differences in the timing of expression of activated BTL
induced by the tracheal GAL4 compared with heat
shock, although we cannot rule out some effect of expression level.
The hypothesis that BTL may act as a chemotactic
guidance receptor is further supported by the recent discovery of a ligand for BTL, the product of the branchless
(bnl) gene (Sutherland et al. 1996). bnl mutations cause
tracheal defects that are strikingly similar to btl defects.
Furthermore, the bnl gene encodes a protein with some
sequence similarity to FGFs and is expressed in the dynamic, spatially restricted pattern consistent with a role
in guidance. In addition, a heat shock bnl transgene increases the level of BTL tyrosine phosphorylation, suggesting that BNL can activate BTL. The spatial distribution of bnl indicates that BTL activity is normally
spatially regulated, whereas our results show that such
regulation is essential to normal tracheal patterning.
The disruption of tracheal cell migration by KBTL reported here contrasts with the effects of a previously
reported, constitutively active BTL receptor, Tor 4~
BTL. Tor4~
does not cause dominant tracheal defects. Furthermore, Tor 4~
can provide partial rescue of tracheal cell migration in btl mutants, in the dor-
sal trunk and some lateral branches (Reichman-Fried et
al. 1994). We also observed dorsal trunk fusion in a minority of segments following expression of hs-KBTL, but
this occurred much later in development than normal. It
may be that some tracheal cells, such as those forming
the dorsal trunk and possibly lateral branches, are
slightly less dependent on spatially localized BTL activity for their directed migration, compared with the cells
forming dorsal, visceral, or ganglionic branches. Thus,
although constitutive BTL activity can rescue some
branches, in a fraction of btl mutant embryos, regulated BTL activity is clearly necessary for tracheal cell
migration to be complete, reproducible, accurate, and
timely.
The inability of Tor4~
to cause dominant defects may be attributable to its low level of activity. We
have shown that Tor4~
is phosphorylated on tyrosine only to low levels because more than half of the
Tor4ml-BTL protein was not detectably tyrosine phosphorylated. The Tor 4~ extracellular domain appears to
confer varying degrees of ligand-independent activity,
depending on the kinase domain to which it is fused.
Although a Tor4~
receptor and Tot 4~ itself do
seem to be constitutively active and biologically potent,
a Tor 4~
chimera did not display the phenotypes expected of a constitutively activated receptor (T.
Schupbach, pers. comm.). It seems likely, then, that the
level of Tor4~
activity is lower than the level of
endogenous, patterned activity, and so does not obscure
the normal pattern of BTL activity and does not cause
dominant defects.
Role of BTL in secondary and terminal tracheal
branching
Unlike primary tracheal branching, which involves the
coordinated rearrangement and migration of cells, formation of secondary and terminal branches are unicellular processes (Samakovlis et al. 1996). Our results indicate that BTL activity may play a different role in secondary and terminal tracheal branching than in primary
branching. The normal pattern of secondary branching
apparently depends on the restriction of high levels of
BTL activity to a small number of cells, because ectopic
secondary and terminal branches were observed in embryos with heat shock-induced expression of kBTL.
However, the observation that reducing endogenous btl
ameliorated the phenotype suggests that the ectopic
branches were attributable to higher than normal levels
of BTL activity in cells that do not normally form secondary branches.
Distinct roles for BTL activity in tracheal cell migration versus branching are also supported by the observation that changes in gene expression are required for tracheal cells to produce secondary and/or terminal
branches, whereas there is no evidence that tracheal cell
migration in response to BTL is mediated through nuclear signaling.
GENES & D E V E L O P M E N T
2919
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Lee et al.
Specificity of BTL R T K signaling in tracheal s y s t e m
development
A l t h o u g h several RTKs h a v e been i m p l i c a t e d in mediating cell m i g r a t i o n (Schuchardt et al. 1994; Bladt et al.
1995; DeVore et al. 1995), the roles of k n o w n downs t r e a m effectors for RTKs in cell m i g r a t i o n r e m a i n unclear. M o s t w e l l - s t u d i e d RTKs appear to share some
c o m m o n d o w n s t r e a m effectors and have s i m i l a r biological a c t i v i t i e s so t h a t one RTK can partially replace another RTK (Dikic et al. 1994). O n e e x a m p l e is t h a t m a n y
RTKs a c t i v a t e the R a s - R a f - M A P k i n a s e p a t h w a y (Brunn e t et al. 1994; Johnson and V a i l l a n c o u r t 1994). However, t h e signaling p a t h w a y m e d i a t i n g R T K - d e p e n d e n t
cell m i g r a t i o n is poorly understood. T h e observation
t h a t a c t i v a t e d SEV, u n l i k e activated BTL, had no signifi c a n t effect on tracheal cell m i g r a t i o n suggests the inv o l v e m e n t of d o w n s t r e a m effectors specific to the migration response.
In c o n t r a s t w i t h the specificity of BTL in tracheal cell
m i g r a t i o n , a c t i v a t e d SEV appeared to have a similar effect as a c t i v a t e d BTL in producing ectopic secondary of
t e r m i n a l b r a n c h - f o r m i n g cells. T h u s c o m m o n downs t r e a m effectors, shared by BTL and SEV, m i g h t m e d i a t e
cell fate d e t e r m i n a t i o n in the tracheal system.
In s u m m a r y , the effects of c o n s t i t u t i v e BTL a c t i v i t y
on t r a c h e a l d e v e l o p m e n t suggest t h a t p a t t e r n e d activat i o n of t h e BTL receptor is required for tracheal cell migration during p r i m a r y b r a n c h f o r m a t i o n as well as for
proper p a t t e r n i n g of secondary and t e r m i n a l cell fates.
A l t h o u g h our data support the h y p o t h e s i s t h a t BTL
could play a direct role in guidance of tracheal cell migration, d e m o n s t r a t i o n of c h e m o t a c t i c behavior of tracheal cells in response to BNL or a n o t h e r ligand w o u l d
be definitive.
Materials and methods
DNA constructs
One pair of primers (h5'-ATTGCGGCCGCCCATGGTTACCTGGAGG and ~,3'-ATTAGATCTCCAGTTGTAAAGGGGAGG) was used to amplify the sequence encoding the dimerization domain of bacteriophage ~ cI repressor from the plasmid
pCIXR (a gift from Enrique Amaya, University of California,
Berkeley) containing a constitutively active Xenopus FGF receptor. After digestion with NotI and BgllI, the PCR-amplified
product was subcloned into pBS containing the btl gene. With
linker tailing, another NotI site was generated on the EcoRI site
located on the 3' end of the BTL open reading frame. Then the
NotI fragment containing the hBTL sequence was subcloned
into the plasmid pCasper-hs.
A standard site-specific mutagenesis (Kunkel et al. 1987) was
performed to mutate the conserved lysine residue within
the ATP binding domain to arginine with the oligonucleotide (ATCGTGGCCGTCCGGATGGTCAAGGAG). Then the
XmnI-XhoI fragment containing the K---~R mutation was subcloned into the kanamycin-resistant vector pHXK containing
the btl gene. Finally, the mutated btl gene was subcloned into
pCasper-hs with NotI as the cloning site.
Fly strains and germ-line transformation
Standard procedures were used for culturing flies and for P ele-
2920
GENES & DEVELOPMENT
ment-mediated germ-line transformation (Rubin and Spradling
1982). w 1118 was used for P element-mediated germ-line transformation, btlH82a3/Tm3 is a fly strain heterozygous for a strong
loss-of-function btl allele (Klambt et al. 1992). hs-btl is a transgenic fly strain carrying a wild-type btl gene under heat shock
promoter control (Murphy et al. 1995). hs-Abtl is a transgenic fly
strain carrying the Abtl fusion gene under heat shock promoter
control, in the pCaSpeR-hs vector (a gift from C. Thummel,
University of Utah, Salt Lake City). hs-btl K~R is a transgenic fly
strain carrying the btl K~R gene in the pCaSpeR-hs vector. Recombinant chromosomes containing either hs-AbtI or hs-btl K--'R
with btl H82a3 were constructed. The UAS-Abtl constructs were
generated by cloning the btl cDNA fragment into the pUAST
vector (Brand and Perrimon 1994). The tracheal GAL4 line used
in this study was kindly provided by A. Brand (Cambridge University, UK).
Heat shock treatment
Egg collection plates containing embryos were placed into petri
dishes and sealed with plastic wrap to prevent desiccation.
Dishes were incubated at 37~ for 40 min to induce expression
of transgenes under heat shock promoter control.
Immunoprecipitation and immunoblotting
Embryos were dechorionated with 50% bleach for 10 min; then,
100 ~1 packed embryos were homogenized in 1 ml of RIPA
buffer (1% Noniodet P-40, 0.5% sodium deoxycholate, 0.1%
SDS, 20 mM Tris at pH 8, 137 mM NaC1, 10% glycerol, and 2 mM
EDTA) containing 100 ~g/ml PMSF at 4~ After incubation on
ice for 15 min, the homogenate was centrifuged at 12,000g for
i0 min. Sodium orthovanidate was added to the supematant to
a final concentration of 0.2 mM. Then the embryo lysate was
incubated with either 8 ~1 a-pY (Upstate Biotechnology #05321) or 8 }xl a-BTL polyclonal mouse antiserum (collected from
balb/c mice, which had been injected three times, two weeks
apart, with gel-purified, His-tagged fusion protein containing
the cytoplasmic portion of BTL) at 4~ overnight. The immune
complex was precipitated with goat antimouse IgG--agarose
(Sigma #A-6531). After washing the agarose with RIPA buffer
three times, it was resuspended in 100 ~xl Laemmli sample
buffer. Prior to electrophoresis, samples were boiled for 5 rain.
After SDS--PAGE, protein was transferred to the nitrocellulose
membrane. Then the membrane was blocked with 4% milk in
PBS for 1 hr, incubated with primary Ab in PBT (1 x PBS, 0.1%
tween-20, and 0.2% BSA) at 4~ overnight, washed with PBS
containing 0.1% tween-20 three times for 10 min each, incubated with peroxidase-conjugated secondary Ab in PBT for one
hour at room temperature, washed with PBS containing 0.1%
tween-20 three times for 10 min each, and finally developed in
PBS containing 0.05% sodium diaminobenzidine and 0.03% hydrogen peroxide.
Immunohistochemistry
Embryos were collected for 1 hr on grape juice agar plates,
treated as indicated in the figure legends, and then fixed at specific stages. Fixation of embryos was carried out as follows.
After dechorionation with 50% bleach for 10 min, embryos
were transferred into fixation buffer consisting of 900 ~1 PEM
(0.1 M Pipes, 2 mM EGTA, and 1 mM Mg2SO 4 with final pH
6.95), 100 fxl 37% formaldehyde, and 300 ~1 n-heptane. After
shaking at room temperature for 30 min, embryos were washed
with methanol five times, and then with PBT three times. After
incubation in PBT for 30 min, embryos were then incubated in
Downloaded from genesdev.cshlp.org on December 19, 2012 - Published by Cold Spring Harbor Laboratory Press
Regulated receptor activity in cell migration
PBT containing 2A12 monoclonal Ab (1:1 dilution) at 4~
overnight. Following five washes with PBT over the course of 2
hr, embryos were incubated in PBT containing biotinylated goat
antimouse IgM (Vector BA-2020) for 2 hr at room temperature.
Following five washes with PBT, embryos were developed with
the Vectastain ABC kit (Vector Labs, Burlingame, CA). The
Pantip-1 marker and the anti-DSRF antisera are described elsewhere (Guillemin et al. 1996; Samakovlis et al. 1996).
Acknowledgments
This work was supported by grant GM46425 from the National
Institutes of Health and by a Lucille P. Markey Scholar Award
to D.J.M.
The publication costs of this article were defrayed in part by
payment of page charges. This article must therefore be hereby
marked "advertisement" in accordance with 18 USC section
1734 solely to indicate this fact.
References
Basler, K., B. Christen, and E. Hafen. 1991. Ligand-independent
activation of the sevenless receptor tyrosine kinase changes
the fate of cells in the developing Drosophila eye. Cell
64" 1069-1081.
Bladt, F., D. Riethmacher, S. Isenmann, A. Aguzzi, and C. Birchmeier. 1995. Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature 376: 768-771.
Brand, A.H. and Perrimon, N. 1994. Raf acts downstream of the
EGF receptor to determine dorsoventral polarity during
Drosophila oogenesis. Genes & Dev. 8: 629-639.
Brunner, D., N. Oellers, J. Szabad, W.H. Biggs III, S.L. Zipursky,
and E. Hafen. 1994. A gain-of-function mutation in Drosophila MAP kinase activates multiple receptor tyrosine kinase signaling pathways. Cell 76: 875-888.
Callahan, C.A., M.G. Muralldhar, S.E. Lundgren, A.L. Scully,
and J.B. Thomas. 1995. Control of neuronal pathway selection by a Drosophila receptor protein-tyrosine kinase family
member. Nature 376: 171-174.
Cheng, H-J., M. Nakamoto, A.D. Bergemann, and J.G. Flanagan.
1995. Complementary gradients in expression and binding of
ELF-1 and Mek4 in development of the topographic retinotectal projection map. Cell 82: 371-382.
DeVore, D.L., H.R. Horvitz, and M.J. Stern. 1995. An FGF receptor signaling pathway is required for the normal cell migrations of the sex myoblasts in C. elegans hermaphrodites.
Cell 83" 611-620.
Dickson, B., F. Sprenger, and E. Hafen. 1996. Prepattern in the
developing Drosophila eye revealed by an activated torsosevenless chimeric receptor. Genes & Dev. 6" 2327-2339.
Dikic, I., J. Schlessinger, and I. Lax. 1994. PC12 cells overexpressing the insulin receptor undergo insulin-dependent
neuronal differentiation. Curr. Biol. 4: 702-708.
Drescher, U., C. Kremoser, C. Handwerker, J. Loschinger, M.
Noda, and F. Bonhoeffer. 1995. In vitro guidance of retinal
ganglion cell axons by RAGS, a 25 kDa tectal protein related
to ligands for Eph receptor tyrosine kinases. Cell 82: 359370.
Fantl, W.J., D.E. Johnson, and L.T. Williams. 1993. Signalling by
receptor tyrosine kinases. Annu. Rev. Biochem. 62" 453481.
Fleischman, R.A. 1993. From white spots to stem cells: the role
of the Kit receptor in mammalian development. Trends
Genet. 9: 285-290.
Glazer, L. and B.-Z. Shilo. 1991. The Drosophila FGF receptor
homolog is expressed in the embryonic tracheal system and
appears to be required for directed trachael cell extension.
Genes & Dev. 5: 697-705.
Guillemin, K., J. Groppe, K. Ducker, R. Treisman, E. Hafen, M.
Affolter, and M.A. Krasnow. 1996. The pruned gene encodes
the Drosophila serum response factor and regulates cytoplasmic outgrowth during terminal branching of the tracheal
system. Development 122" 1353-1362.
Johnson, G.L. and R.R. Vaillancourt. 1994. Sequential protein
kinase reactions controlling cell growth and differentiation.
Curr. Biol. 6: 230-238.
Klambt, C., L. Glazer, and B.Z. Shilo. 1992. breathless, a Drosophila FGF receptor homolog, is essential for migration of
tracheal and specific midline glial cells. Genes & Dev.
6: 1668-1678.
Kundras, V., J.A. Escobedo, A. Kazlauskas, H.K. Kim, S.G. Rhee,
L.T. Williams, and B.R. Zetter. 1994. Regulation of chemotaxis by the platelet-derived growth factor receptor-beta. Nature 367: 47~476.
Kunkel, T.A., J.D. Roberts, and R.A. Zakour. 1987. Rapid and
efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154: 367-382.
Manning, G. and M.A. Krasnow. 1993. Development of the
Drosophila tracheal system. In The development of Drosophila melanogaster. (ed. M. Bate, and A.M. Arias), pp. 609685. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Montell, D.J. 1994. Moving right along: Regulation of cell migration during Drosophila development. Trends Genet.
10: 59-62.
Murphy, A.M., T. Lee, C.M. Andrews, B.Z. Shilo, and D.J. Montell. 1995. The Breathless FGF receptor homolog, a downstream target of Drosophila C/EBP in the developmental
control of cell migration. Development 121: 2255-2263.
Obermeier, A., R.A. Bradshaw, K. Seedorf, A. Choidas, and J.
Schlessinger. 1994. Neuronal differentiation signals are controlled by nerve growth factor receptor/Trk binding sites for
SHC and PLC% EMBO ]. 13: 1585-1590.
Reichman-Fried, M. and B.-Z. Shilo. 1995. Breathless, a Drosophila FGF receptor homolog, is required for the onset of tracheal cell migration and tracheole formation. Mechanism of
Development 52: 265-273.
Reichman-Fried, M., B. Dickson, E. Hafen, and B.Z. Shilo. 1994.
Elucidation of the role of breathless, Drosophila FGF receptor homolog, in tracheal cell migration. Genes & Dev.
8: 428-439.
Rubin, G.M. and A.C. Spradling. 1982. Genetic transformation
of Drosophila with transposable element vectors. Science
218: 348-353.
Samakovlis, C., N. Hacohen, G. Manning, D. Sutherland, K.
Guillemin, and M.A. Krasnow. 1996. Branching morphogenesis of the Drosophila tracheal system occurs by a series of
morphologically distinct but genetically coupled branching
events. Development 122: 1395-1407.
Schuchardt, A., V. D'Agati, L. Larsson-Blomberg, F. Costantini,
and V. Pachnis. 1994a. Defects in the kidney and enteric
nervous system of mice lacking the tyrosine kinase receptor
Ret. Nature 367" 380-383.
Sutherland, D., C. Samakovlis, and M.A. Krasnow. 1996.
branchless encodes a Drosophila fibroblast growth factor homolog that controls tracheal cell migration and branching.
Cell (in press).
GENES & DEVELOPMENT
2921
Fly UP