...

Identificação da Proteína Envolvida no Olfato de

by user

on
Category: Documents
1

views

Report

Comments

Transcript

Identificação da Proteína Envolvida no Olfato de
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Identificação da Proteína Envolvida no Olfato de Pheidole
sp. (Hymenoptera: Formicidae): Morfo-espécie Responsável
por Casos de Infecção Hospitalar
Marcos Filipe Pesquero1 PBIC, João Bosco Pesquero2,
Lauro Thiago Turaca3, Marcos Antônio Pesquero4
Universidade Estadual de Goiás – Unidade de Morrinhos. CEP 75650-000, Brasil.
1
[email protected], [email protected],
3
[email protected], [email protected]
Palavras-Chave: Proteína-Químico-Sensorial (CSP), Infecção-hospitalar, Feromônio,
Inseto-social.
1
INTRODUÇÃO
A infecção hospitalar tem despertado grande interesse no meio científico
devido à elevação das taxas de morbimortalidade de pacientes hospitalizados e a
sua ocorrência depende das condições sanitárias e da presença de vetores dos
microrganismos patogênicos (QUIRINO, 1997). Várias espécies de formigas se
beneficiam com a presença do homem e algumas destacam-se como pragas devido
aos problemas ocasionados direta ou indiretamente à população humana (VINSON,
1986; VANDER MEER et al., 1990). Espécies de formigas que vivem no interior de
edificações em ambiente urbano são caracterizadas pelo tamanho corporal
pequeno, mobilidade das colônias, unicolonialismo e poliginia (PASSERA, 1994).
As principais espécies consideradas pragas urbanas no Brasil são exóticas,
destacando-se
Monomorium
pharaonis
(L.),
Monomorium
floricola
Jerdon,
Paratrechina longicornis (Latreille) e Tapinoma melanocephalum (Fabricius).
Linepithema humile (Mayr), Paratrechina fulva (Mayr), Wasmannia auropunctata
(Roger) e algumas espécies de Camponotus, Pheidole, Brachymyrmex e
Solenopsis, nativas do Brasil, também são consideradas importantes pragas
urbanas (CAMPOS-FARINHA et al., 2002).
1
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Levantamentos da fauna de formigas em hospitais do Brasil demonstram que
esses insetos transportam microrganismos patogênicos, sendo importantes vetores
de bactérias resistentes a antibióticos (PEÇANHA, 2000; RODOVALHO et al. 2007;
CARNEIRO et al., 2008.), representando risco potencial de infecção em hospitais
devido à sua grande mobilidade no interior destes ambientes (FOWLER et al., 1993;
BUENO & FOWLER, 1994; COSTA et al.; 2006; PESQUERO et al., 2008).
Métodos preventivos de colonização e forrageio das formigas são também
importantes para o controle da disseminação de doenças em ambiente hospitalar
(QUIRINO, 1997). Dados sobre biologia, ecologia e distribuição espacial contribuem
para o manejo de formigas-praga direcionando as ações de controle e dessa forma,
reduzindo custos e riscos de contaminação ambiental (ZARZUELA et al., 2002).
A comunicação entre as formigas ocorre através de sinais químicos
denominados feromônios, que determinarão no indivíduo receptor uma resposta
comportamental e/ou fisiológica adaptativa em atividades diversas tais como
reprodução, forrageio e defesa. Enquanto a emissão do sinal pode se originar de
glândulas localizadas em várias partes do corpo, a recepção do sinal químico
normalmente
ocorre
em
órgãos
especializados
denominados
de
antenas,
localizados na região cefálica e conectados ao deutocérebro (CORRÊA &
SANT’ANA, 2001; LIMA & DELLA-LUCIA, 2001). No ápice das antenas, genes
codificam proteínas específicas responsáveis pelo transporte dos feromômios e
outros semioquímicos da cutícula aos nervos receptores olfativos (VOGT, 2003).
Tais proteínas químico-sensoriais (CSP) apresentam resíduos de cisteína bem
conservados (PIKIELNY et al., 1994), sendo recentemente identificada em
Solenopsis invicta (LEAL & ISHIDA, 2008), espécie de formiga com maior número de
estudos sobre expressão gênica devido à sua importância como praga introduzida
nos EUA (BACCI Jr, 2007).
Várias pesquisas têm sido desenvolvidas com insetos da ordem Hymenoptera
para estudo da expressão gênica diferencial e dos processos biológicos (LOBO et al.
2003; TIAN et al. 2004). O gênero Pheidole ainda é pouco explorado nas questões
biomoleculares, mas acredita-se na hipótese que as proteínas envolvidas na
comunicação olfativa sejam a explicação para o comportamento poligínico desta
espécie. Ferreira & Grattapaglia (1998) afirmaram que a utilização de marcadores
2
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
moleculares visando obter análise filogenética, divergência gênica, identificação do
genótipo, avaliação de germoplasma, fisiologia e outras características moleculares,
são importantes ferramentas para se esclarecer a causa poligínica e responder
questões taxonômicas de espécies ainda pouco estudadas. Contudo, a extração de
DNA para realização destes estudos, deve possuir metodologias otimizadas para se
obter material genético de qualidade, estando ciente que o porte destes animais, por
serem insetos, dificulta ainda mais o processo de extração deste material
(WALDSCHMIDT et al., 1997).
2
MATERIAL E MÉTODOS
2.1 Extração de RNA total
Para a extração do RNA total, amostras de antenas (1000) e abdomens (500)
de formigas operárias e rainhas Pheidole sp. coletadas em hospital e mantidas vivas
até o momento das análises, foram homogeneizados, separadamente, em presença
de TRIzol (Invitrogen) na proporção de 1mL de TRIzol por 100mg de tecido. A
mistura foi passada 3 vezes na ponteira e incubadas por 5 minutos a temperatura
ambiente para dissociação dos complexos nucleoproteicos. Para preciptação do
RNA presente no homogenato, 200
L de clorofórmio por mL de TRIzol utilizado
foram adicionados. Essa mistura foi agitada por inversão por 15 segundos e
centrifugada a 12000 g por 15 minutos a 4 ºC. Após centrifugação, a fase superior
que contém o RNA foi recolhida, tranferida para um novo tubo livre de RNAses e
adicionou-se 500
L de isopropanol para cada mL de TRIzol e novamente a
centrifugação por 10 minutos a 4 ºC e 12000 g. O RNA precipitado foi então lavado
com 1 mL de etanol 70% preparado com H2O MilliQ, seco à temperatura ambiente e
re-suspendido
em
H2O
MilliQ.
A
concentração
de
RNA
foi
medida
espectrofotometricamente em Nanodrop e sua integridade avaliada em gel de
agarose 1%.
3
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
2.2 Identificação da sequência do gene CSP
A sequência do gene de Pheidole sp. que expressa a proteína químicosensorial (CSP) localizada na antena foi identificada através das ligações de
oligonucleotídeos (primers) que se localizam no início e término da sequência do
RNA mensageiro do gene de S. invicta (Número de acesso Genebank AY713302). A
reação em cadeia da polimerase (RCP) foi executada em diferentes temperaturas de
anelamento para se verificar uma possível amplificação e padronização do gene
CSP de Pheidole sp.
2.3
Reação de Transcrição Reversa
Em um micrograma de RNA foi feito transcrição reversa utilizando a enzima
Moloney Murine Leukemia Virus reverse transcriptase (Invitrogen). A fita de cDNA foi
sintetizada do RNA total com iniciadores oligodT.
2.4
Reação da Polimerase em Cadeia (RPC)
A 2 L de cDNA sintetizado anteriormente foi adicionada uma solução (mix)
contendo 0,5 L de dNTPs (desoxirribonucleotídeos trifosfatos) 10 mM; 0,5 L de
oligonucleotídios (forward e reverse, 10 mM cada); 1,5 L de MgCl2 50 mM; 6 L de
solução tampão 5X concentrada; 0,2 L da enzima [GoTaq Flexi DNA Polymerase
(Promega, Madison - USA)] e 14,3
L de água Milli-Q para completar 25
L de
reação. A reação foi amplificada em termociclador segundo as programações de
ciclos (Quadro 1).
4
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Quadro 1. Programações de ciclos utilizados na PCR.
Temperatura
Tempo
Número de ciclos
95 C
3 minutos
1 ciclo
95 C
5 segundos
60 C
15 segundos
72 C
40 segundos
72 C
7 minutos
1 ciclo
4 C
Indefinido
1 ciclo
35 ciclos
2.5 Oligonucleotídeos utilizados baseados na sequência do gene da CSP de
Solenopsis invicta
Primer Forward: 5´CTAGTATCCAGGTACTGCG 3´
Primer Reverse: 5´ TTAGGCTCGGGCATCTTCAAG 3´
Amplicom: aproximadamente 375 pb.
2.6
Purificação (Kit Qiagen)
As bandas apresentadas no gel de agarose após a RT-PCR foram removidas
com o auxílio de um bisturi e a fatia do gel foi transferida para um tubo de reação de
1,5 mL. O gel foi solubilizado pela adição de Buffer QG na proporção de 3 volumes
de tampão para cada volume de gel. As amostras foram incubadas a 50 °C por 10
minutos e em seguida foi adicionado um volume de isopropanol 100% para cada
volume de gel. A solução foi transferida para uma coluna acoplada a um tubo de 2,0
mL e centrifugada a 10000 x g por um minuto. O conteúdo líquido do tubo foi
removido, sobre a coluna e adicionou-se 0,5 mL de tampão QG, centrifugando-o a
1000 x g por um minuto. Em seguida, foram adicionados 0,75 mL de tampão PF e
centrifugou-o a 10000 x g por um minuto. A coluna foi transferida para um tubo de
1,5 mL e a amostra eluida em 30 μL de buffer EB (10 mM Tris-Cl, ph 8,5).
5
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Após a purificação, 3 μL de cada amostra foram submetidos à eletroforese em
gel de agarose 2%. Os produtos foram novamente identificados de acordo com o
peso molecular.
2.7
Ligação do fragmento amplificado ao plasmídeo PGeim-T
O fragmento amplificado e o plasmídeo pGEM-T foram ligados para a
formação do vetor pGEM-T-CSP, utilizando-se a enzima T4 ligase (BioLabs Corp.),
conforme o protocolo: adição de 2
L do tampão de ligação (4x), adição de 3:1
relação fragmento/plasmídeo e adição de 1 L da enzima T4 ligase para um volume
final de 20
L, incubando “overnight” a 4 ºC. Um volume de 10uL da reação de
ligação foi utilizado para a transformação de bactérias E. coli. A seguir está indicado
a fórmula utilizada para o cálculo das proporções das amostras na reação de
ligação, o mapa do plasmídeo PGeim-T easy e os sítios de clivagem das enzimas
de restrição (Figura 1).
2.8 Quantidade inserto (ng) = Quantidade de vetor (ng) X tamanho inserto
(kbp) / tamanho vetor (kbp) X 3/1
Figura 1. Mapa do plasmídeo PGeim-T easy
restrição.
6
e os sítios de clivagem das enzimas de
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
2.9
Bactérias competentes
Bactérias E. coli Top 10F’ congeladas a -80°C foram inoculadas em 5 mL de
meio LB e incubadas à 37°C por 12 horas com agitação à 170 rpm. Adicionou-se 0,5
mL de células à 100 mL de meio LB e levou-se à 37°C, com agitação a 160 rpm. O
OD600 foi medido a cada 30 min até que chegou-se ao valor de 0,5. As células
foram ressuspensas, levadas ao gelo durante 20 minutos e centrifugadas a 5000xg
por 5 minutos a 4°C,.
As células foram ressuspensas na metade do volume da cultura original
estéril-filtrada 0,1M CaCl2.
Adicionou-se glicerol esterilizado à célula para uma
concentração final de 25% (v / v) e 50% LB (v/v) até que foram armazenadas à 80°C até a utilização.
2.10 Transformação de bactérias
Para transformação, bactérias E. coli competentes (linhagem TOP10F’) foram
transformadas e cultivadas em meio LB Broth, contendo o antibiótico Ampicilina
como marcador de seleção (concentração de 100 µg/mL). A transformação das
bactérias E. coli foi feita mediante o seguinte protocolo: adição de 20 µL do
plasmídeo pGEM-T-CSP em 200ul de bactérias competentes e 800 µL de LB;
incubação no gelo por 30 minutos; choque térmico a 42 ºC por 1 minuto; choque
térmico no gelo por 5 minutos e incubação sob agitação de 250 rpm a 37ºC por 90
minutos. Após o processo de transformação, as bactérias foram plaqueadas em
placa de Petri contendo 20 mL de meio LB Agar com Ampicilina na concentração de
100 µg/mL, 100μl de IPTG 100mM e 20μl de X-Gal (50mg/ml) para a seleção das
bactérias contendo o plasmídeo. As placas foram incubadas à 37° C por 20 horas.
2.11 Análise da transformação
Após o crescimento das colônias, estas foram submetidas à PCR e o produto
desta à digestão com a enzima de restrição Eco RI, para verificação do tamanho do
inserto clonado. Após a confirmação foi feito o processo de Mini-prep para produção
7
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
do plasmídeo. Tendo sido confirmado o crescimento e a transformação, as colônias
isoladas foram inoculadas em 5mL de meio LB contendo 100 µg/mL de Ampicilina e
cultivadas em estufa a 37 ºC para crescer por um período de 12-16 horas.
2.12 Miniprep
Soluções Mini-prep:
Meio de cultura LB
20g/L LB Broth Base (Lennox L Broth Base, Invitrogen Cat. # 12780’052),
autoclavada e estéril.
Solução A (GET)
p/100mL
Glicose 50mM
0,9 g Glicose
Tris HCl 25mM pH 8,0
2,5 mL Tris HCl 1M pH 8,0
EDTA 10 mM
2,0 mL EDTA 0,5 M
Antes do uso adicionou-se 30µL de RNAse A (4mg/mL) a cada 70µL da solução A
Solução B
p/100mL
NaOH 200mN
2,0mL NaOH 10N
SDS 1%
5,0 mL SDS 20% em H2O
Solução C
KAc (acetato de potácio) 3M
p/100mL
29,44g
HAc (ácido ácetico glacial) 5mL 8,7mL do estoque
TE
Tris HCl 10mM pH 7.4 + EDTA 1mM pH8.0
EDTA 0,5M
18,6g EDTA2H2O em 100mL H2O ajuste o pH para 8,0 com NaOH e autoclave.
8
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
As bactérias em meio LB foram centrifugadas a 10.000 x g por 30 segundos.
O sobrenadante foi descartado e o pellet ressuspenso em 100µL da solução A com
RNase. Adicionou-se 200 µL da solução B e incubou-se à temperatura ambiente por
5 minutos. Adicionou-se 200µL da solução C, seguido de centrifugação a 10.000 x g
por 10 minutos. O sobrenadante foi transferido para tubo de 1,5 mL. Adicionou-se
300µL de isopropanol 100% e centrifugado a 12.000 x g por 10 minutos. Lavou-se o
pellet com etanol (500µL) 70%-75% e centrifugou-se a 12.000 x g por 5 minutos. O
sobrenadante foi completamente retirado, deixando o tubo 15 minutos à 60ºC.
Resuspendeu-se o pelllet em 50µL de água e a concentração de DNA foi medida em
Nanodrop ND 1000.
2.14 Sequenciamento
O sequenciamento foi realizado utilizando-se o método automático com
corante fluorescente (ABI Prism BigDye Terminator v3.1 Cycle Sequencing Kits,
Applied Biosystems) no aparelho ABI PRISM 377 DNA Sequencer (Applied
Biosystems). Os oligonucleotídeos utilizados no sequenciamento foram os mesmos
utilizados na PCR.
A 100ng do vetor adicionou-se 3,2 pmoles de cada oligonucleotídeo (forward
e reverse), 1 μL de solução Big Dye , 1 μL do tampão de reação 10x e água Milli-Q
para um volume final de 10 μL. Amplificou-se a reação em termociclador segundo as
programações de ciclos (Quadro 2).
9
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Quadro 2. Programações de ciclos utilizadas para amplificação da reação de
sequenciamento.
Temperatura Tempo
94 C
94 C
48 C
Número de ciclos
5
segundos
1 ciclo
20
segundos
10
segundos
60 C
4 minutos
4 C
Indefinido
25 ciclos
1 ciclo
Posteriormente, a reação foi purificada por precipitação pela adição de 40 μL
de isopropanol 75%, seguida de agitação e incubação à temperatura ambiente por
15 minutos. Após a centrifugação (4000 g/30 minutos/25 °C), desprezou-se o etanol
e 200 μL de isopraponol 75% foram adicionados. Em seguida, centrifugou-se
novamente as amostras, o sobrenadante foi desprezado e as amostras incubadas a
90°C por 1 minuto para completa evaporação do isopropanol. O precipitado de DNA
foi re-suspendido em 2 μL de tampão de corrida (Blue Dextran), as amostras
denaturadas a 95°C por 2 minutos e imediatamente colocadas em gelo até o
momento da aplicação no gel.
A última etapa do sequenciamento consistiu na corrida eletroforética das
amostras em gel de poliacrilamida (Long Ranger) 5%/Uréia 6M, em tampão TBE
(1X), por 7 horas, no sequenciador ABI Prism 377. As sequências obtidas foram
comparadas à sequência de referência e todas as alterações foram confirmadas
pelo sequenciamento da fita reversa.
10
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
3
RESULTADOS E DISCUSSÃO
A extração de RNA pela metodologia do Trizol resultou em um padrão de
banda semelhante ao observado por (RODOVALHO, 2006) com formigas operárias
e soldados de Camponotus vittatus (Figura 2).
a)
b)
Figura 2: padrão de bandas da extração de RNA. a) Pheidole sp. b) Camponotus vittatus.
Tendo inicialmente aplicado iniciadores RH, ao correr as amostras no gel não
houve
resultados
significantes
em
bandas.
Essas
amostras
foram
então
descartadas, sendo substituídos os iniciadores RH pelos iniciadores Oligo DT. Na
primeira RT-PCR realizada com temperatura de anelamento a 60°C surgiram
bandas fracas. Dessa forma, realizamos o rePCR com temperaturas de anelamento
mais baixas (55 °C e 58 °C) que as indicadas pelo protocolo, nas quais obtivemos
insertos satisfatórios às alturas de 1000pb e 500pb (Figura 3).
11
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
1000pb
500pb
Figura 3. Padrão de bandas do rePCR de Pheidole sp. às temperaturas de anelamento a
55°C e 58°C.
Após a digestão do vetor pGEM-T-CSP com enzimas de restrição ECO RI,
pode-se observar os insertos de 500 e 1000 pb inseridos no vetor. Devido aos
tamanhos serem correspondentes ao esperado, iniciamos o sequenciamento do
vetor para análise da seqüência clonada e posterior verificação de homologia com a
seqüência do gene de S. invicta (Figura 4). As seqüências serão alinhadas (BioEdit
7, 2004; Multialin, http://prodes.toulouse.inra.fr/multalin/multalin.html), traduzidas
(Expasy Proteomics Server, http://www.expasy.org/tools/dna.html) e comparadas
com o banco de dados GenBank o mais rápido possível. As seqüências resultantes
serão depositadas no banco de dados público dbEST.
A condição predominante da sensibilidade a componentes químicos voláteis
que orientam as atividades dentro e fora das colônias de formigas, assim como sua
determinação genética, têm auxiliado estudos filogenéticos a compreender a
evolução dentro das principais ordens de insetos. Xu et al. (2009) concluíram que as
CSP’s são mais conservativas dentro das ordens de insetos do que as OBP’s,
indicando que o aparecimento da maioria dos genes dessas famílias de proteínas
difere entre si quanto ao período de diversificação das ordens. González et al.
12
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
(2009) encontraram três grupos distintos de himenópteras nas análises de CSP’s.
Um desses grupos é composto exclusivamente por Formicidae e, suas análises
sugerem ser uma evolução mais recente dentro da subfamília Myrmicinae.
Os
autores ainda encontraram uma proteína (Si-CSP1) altamente expressa nas antenas
de S. invicta, sugerindo uma função olfativa. Os resultados aqui obtidos com todo o
corpo de formigas operárias demonstram a expressão genética dessa família de
proteínas (CSP) em Pheidole sp., sendo necessários estudos envolvendo partes
isoladas do corpo (antena e abdome) para se poder sugerir suas funções.
3000pb
1000pb
500pb
Figura 4. Amostras da clonagem do gene CSP no vetor p-GEM-T-CSP corridas no gel de
agarose.
4 CONCLUSÕES
Pelo menos uma proteína químico-sensorial (CSP) foi encontrada na espécie
Pheidole sp. tendo base em gene específico de S. invicta. Portanto, todo o
conhecimento futuro adquirido nessa área para o controle de S. invicta nos EUA
pode contribuir também para o controle de Pheidole sp. no Brasil. Entretanto, mais
estudos envolvendo o seqüenciamento e análise isolada de partes do corpo da
formiga são relevantes para essa finalidade.
13
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
REFERÊNCIAS BIBLIOGRÁFICAS
Bacci Jr, M. Formigas como modelo de estudo em biologia molecular. Biológico 69: 173176, 2007.
Bueno, O. C.; H. G. Fowler. Exotic ants and native ant fauna of Brasilian hospitals, p.191198. In Williams, D.F. (org.). Exotic ants: Biology, impact and control of introduced species.
Boulder, Westview Press, 1994.
Campos-Farinha, A. E. C.; O. C. Bueno, M. C. G. Campos; L. M. Kato. As formigas urbanas
no Brasil: retrospecto. Arquivos do Instituto Biológico. 64: 129-133, 2002.
Carneiro, L. C.; T. T. Carvalhares; M. A. Pesquero; R. C. Quintana; S. B. Feitosa; J. Elias
Filho; M. A. C. Oliveira. Identificação de bactérias causadoras de infecção hospitalar e
avaliação da tolerância a antibióticos. NewsLab 86: 106-114, 2008.
Coorêa, A.G. & J. Sant’Ana. Fundamentos de comunicação química de insetos. P. 9-22 In:
Ferreira, J.T.B.; A.G. Corrêa; P.C. Vieira (orgs.). Produtos naturais no controle de
insetos. São Carlos: Edufscar, 2001.
Costa, S. B.; A. Pelli; G. P. Carvalho; A. G. Oliveira; P. R. Silva; M. M. Teixeira; E. Martins;
A. P. S. Terra; E. M. Resende; C. C. Hueb; B. Oliveira; C. A. Morais. Formigas como vetores
mecânicos de microorganismos no Hospital Escola da Universidade Federal do Triângulo
Mineiro. Rev. Soc. Bras. Med. Tropical. 39: 527-529, 2006.
Rodovalho, C. M.; Santos, A.L.; Marcolino, M.T.;Bonetti, A.M.;Brandeburgo, M.A.M. Urban
Ants and Transportation of Nosocomial Bacteria. Neotropical Entomology 36(3):454-458,
2007.
Ferreira, M.E.; Grattapaglia, D. Introdução ao uso de marcadores moleculares em
análise genética. 3.ed. Brasília:Embrapa-Cenargem, 1998.
Fowler, H. G.; O. C. Bueno; T. Sadatsune; A. C. Montelli. Ants as potential vectors of
pathogens in Brazil hospitals in the state of São Paulo, Brazil. Insecta Science and its
Application. 14: 367-370, 1993.
González, D.; Q. Zhao; C. McMahan; D. Velasquez; W.E. Haskins; V. Sponsel; A. Cassill; R.
Renthal. The major antennal chemosensory protein of red imported fire ant workers. Insect
Mol Biol, v. 18, n. 3, p. 395–404, 2009.
Leal, W. S.; Y. Ishida. GP-9s Are Ubiquitous Proteins Unlikely Involved in Olfactory
Mediation of Social Organization in the Red Imported Fire Ant, Solenopsis invicta. PLoS
ONE 3: 1-9, 2008.
Lima, E. R.; M. C. Della-Lucia. Biodinâmica dos feromônios, p. 13-25, In Vilela, E. F.; M. C.
Della-Lucia (eds.) Feromônios de insetos. 2 ed. Ribeirão Preto: Holos, 2001.
Lobo, N.F.; L.Q.Ton; C.A. Hill; C. Emore; J. Romero-Severson; G.J. Hunt; F.H. Collins.
Genomic analysis in the sting-2 quantitatiive trait locus for defensive behavior in the honey
bee, Apis mellifera. Genome Res, v. 13, p.2588-2593, 2003.
14
Anais do VIII Seminário de Iniciação Científica e V Jornada de Pesquisa e Pós-Graduação
UNIVERSIDADE ESTADUAL DE GOIÁS
10 a 12 de novembro de 2010
Passera, L. Characteristics of tramp species. pp. 23-43 in: William, D.F. (ed.) Exotic ants.
Westview Studies in Insect Biology, 1994.
Peçanha, M.P. 2000. Formigas como vetor de propagação bacteriana no Conjunto
Hospitalar de Sorocaba, SP. Tese de Doutorado,UNESP, São Paulo, 110p.
Pesquero, M. A.; J. Elias Filho; L. C. Carneiro; S. B. Feitosa; M. A. C. Oliveira; R. C.
Quintana. Formigas em Ambiente Hospitalar e seu Potencial como Transmissoras de
Bactérias. Neotropical Entomology. 37: 472-477, 2008.
Pikielny, C. W.; G. Hasan; F. Rouyer; M. Rosbash. Members of a family of Drosophila
putative odorant-binding proteins are expressed in different subsets of olfactory hairs.
Neuron 12: 35–49, 1994.
Quirino, N. E. P. S. Controle da água e vetores. pp: 219-228 in: Couto, R.C. et al. (eds.)
Infecção hospitalar: Epidemiologia e controle. MEDSI, São Paulo, 1997.
Rodovalho, C. M. Detecção de genes diferencialmente expressos na formiga urbana
Camponotus vittatus (Hymenoptera, Formicinae). Tese de mestrado. UFU, Uberlândia,
2006. 37p.
Tian, H.; S.B. Vinson; C.J. Coates. Differential gene expression between alate and dealate
queens in the red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae).
Insect Biochem Mol Biol, v. 34, p. 937-949, 2004..
Vander Meer, R. K.; K. Jaffè; A. Cedeno. Applied myrmecology: a world perspective.
Westview Press, Boulder (CO), 1990.
Vinson, S. B. Economic impact and control of social insects. Praeger, New York, 1986.
Vogt, R. G. Biochemical diversity of odor detection: OBPs, ODEs and SNMPs. p. 391–445 In
Blomquist, G. J.; R. G. Vogt (eds.). Insect pheromone biochemistry and molecular
biology: the biosynthesis and detection of pheromones and plant volatiles. Londres: Elsevier
Academic Press, 2003.
Xu, Y.; P. He; L. Zhang; S. Fang; S. Dong; Y. Zhang; F. Li. Large-scale identification of
dorant-binding proteins and chemosensory proteins from expressed sequence tags in
insects. BMC Genomics, 10:632, 2009. Disponível http://www.biomedcentral.com/14712164/10/632. Acessado: 15/06/2010.
Waldschmidt, A.M.; Salomão, T.M. Barros, E.G.; Campos, A.O. Extraction of genomic DNA
from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae). Brazilian Journal of
Genetics. v.20, n.3, p.421-423, 1997.
Zarzuela, M. F. M.; M. C. C. Ribeiro; A. E. C. Campos-Farinha. Distribuição de formigas
urbanas em um hospital da região sudeste do Brasil. Arquivos do Instituto Biológico. 69:
85-87, 2002.
15
Fly UP